R e v i e w o f l i t e r a t u r e P a g e

R e v i e w o f l i t e r a t u r e
P a g e | 9
2.1 Diarrheagenic E. coli
Escherichia coli is the predominant inhabitant of the gastrointestinal tract of humans and
animals which usually remains as a harmless commensal ( Welch, 2006 ; Nataro et al., 1998).
They reside in the terminal small intestine and large intestine of mammals. They are
ubiquitous in the environment ( Welch,2006 ). These commensal strains can cause infections
inimmunocompromised patients or when barriers of gastrointestinal tract are violated (Nataro
et al., 1998).
The pathogenic strains of E. coli can cause infections in intestinal sites and extraintestinal
sites. The strains those can cause intestinal infections are called Diarrheagenic E. coli (DEC)
while those can cause extra-intestinal infections are called Extra-intestinal pathogenic E. coli
(ExPEC) ( Welch,2006 ).
. ExPEC is further classified into Uropathogenic E. coli (UPEC) and
Neonatal Meningitis E. coli (NMEC). DEC includes six pathovars such as Enteropathogenic
E. coli (EPEC), Enteroaggregative E. coli (EAEC), Enterotoxigenic E. coli ,
Enterohaemorrhagic E. coli (EHEC), Enteroinvasive E. coli (EIEC) and Diffusely adherent
E. coli (DAEC)
( Welch, 2006 ).
2.2 History of discovery
E. coli was first described by Theodor Escherich in 1885 who was a German paediatrician
and microbiologist worked on infantile Diarrhoea. He recovered a bacterium from stool
samples and named it Bacterium coli commune . It was renamed Escherichia coli in the
honour of the discoverer in 1985 (Shulman et al., 2007).
The role of E. coli in infantile diarrhoea was demonstrated by Bray in 1945. He isolated
certain serotypes of E. coli from patients with summer diarrhoea. Later in 1948, Bray and
Beaven emphasized their association with infantile diarrhoea (Ewing et al., 1955). The strains
were called as Bacterium coli var neapolitanum which is later labelled as E. coli o111: B4
(Bray et al., 1945). In 1947, Giles and his co-workers described the second serotype , E. coli o
55: B5, which is associated with diarrhoea (Ewing et al., 1955). Thereafter several serotypes
were isolated from different parts of the world. E. coli o111: B4 strains were named as
Enteropathogenic E. coli by Neter et al in 1955 (Law et al., 1988).
In 1956, De and his colleagues conducted Rabbit –ileal loop experiment to study the
enterotoxic activity of E. coli strains, isolated from patients with the cholera-like illness. They
found out that some strains possessed enterotoxic activity but the activity of the culture

R e v i e w o f l i t e r a t u r e
P a g e | 10
filtrate was not determined (Law et al., 1988). In 1958, Taylor et al also detected the similar
activity of some E. coli strains. R.B. Sack et al discovered a group of E. coli strains that could
produce diarrhoea in 1968 and it is called as Enterotoxigenic E. coli (Law et al., 1988).
Konowalchuk et al discovered the production of cytotoxins in some E. coli strains in 1977.
The toxin was differed from other enterotoxins and was toxic for Vero cells. Hence the name
Verotoxin was given (Konowalchuk et al., 1977)
. In 1980, Scotland et al detected Verotoxin
production in traditional E. coli strains and later in 1983, they found out that the VT genes
were carried on bacteriophage (Law et al., 1988). In 1982, Riley et al reported the association
of E. coli strains belonging to O157 serogroup with haemorrhagic colitis. Johnson et al and
O’Brien et al independently discovered that these strains could produce a large amount of
Verotoxin in 1983. In 1984, Levin and Edelman implicated these strains as the cause of
Haemorrhagic Colitis and termed Enterohaemorrhagic E. coli (EHEC) (Law et al., 1988).
The pathological changes that had occurred in the intestinal mucosa during some EPEC
infection were first studied by Staley et al in 1969 and they demonstrated the attachment and
effacement of microvilli from intestinal epithelial cells. Cravioto et al (1979) observed the
adherence of these EPEC strains on Hep-2 cells. In 1983, Baldini et al proved the existence of
a plasmid of molecular weight 50-70×10 6
in the strains that had adherence property. His
experiments proved its association with adherence property and the plasmid was later named
as EPEC adherence factor (EAF) by Levine et al in 1985 (Law et al., 1988). In 1984,
Scaletsky et al studied the pattern of adherence of these strains on HeLa cells and found out
that the strains exhibited two types of adherence pattern ie Localized adherence (LA) and
Diffused adherence (DA) and these strains were named as Attaching and Effacing E. coli
(AEEC) by Moon et al in 1983. Later these adhesive non-toxigenic EPEC strains that can
cause diarrheal disease were designated as Entero Aggregative E. coli (EAEC) by Mathewson
et al in 1985 (Law et al., 1988).
Ewing and Gravatti reported EIEC for the first time in 1947. At that time, it was known as
Paracolon bacilli but later renamed as 0124 E. coli . In the 1950s the E. coli strains that can
cause keratoconjunctivitis were named as EIEC (Pasqua et al., 2017)
2.3 Cell: structure and physiology
E. coli is Gram-negative, a rod-shaped bacterium belongs to the genus Escherichia , family
Enterobacteriaceae (Croxen et al., 2013, Nataro et al.,1998). It is approximately 0.5µm in
diameter and 1-3 µm I length. It can be either non-motile or motile, with peritrichous flagella.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

R e v i e w o f l i t e r a t u r e
P a g e | 11
It is a facultative anaerobe, can be grown aerobically or anaerobically and the optimum
temperature for growth is 3 C. It can grow in the pH range of 5.5-8.0 with optimum growth77
at neutrality (Welch, 2006). E. coli strains can be isolated from fecal samples by using
several selective media (Croxen et al., 2013). It is capable of reducing nitrates to nitrites. It
ferments lactose, glucose, sucrose with the production of acid and gas except for EIEC strains
which fail to ferment lactose (Welch, 2006). They can also ferment D-mannitol, D-sorbitol,
L-arabinose, Maltose, Trehalose and D-Mannose. D-Sorbitol can be utilized except 0157: H7
strains. Most diarrheagenic strains cannot ferment D-serine while commensal strains and
uropathogenic strains utilize this enantiomer of serine (Welch, 2006).
E. coli strains produce Indole in Tryptophan containing media. The strains are Methyl Red
positive and Voges Proskauer negative. Most of them are negative for oxidase production,
Citrate utilization, urease production and hydrogen sulphide production (Welch, 2006).
Figure 1. Electron micrograph of E. coli
(www.bacteriainphotos.com)
2.4 Typing
Different methods are being used for the typing of DEC strains since the discovery of DEC.
Serotyping, Pulsed Field Gel Electrophoresis (PFGE), Multi Locus Sequence Typing (MLST)
are the main methods used for typing (Croxen et al .,2013).
Serotyping had a significant role in the identification of diarrheagenic E. coli prior to
molecular detection of specific virulence factors (Nataro et al., 1998). In 1944, Kaufmann
proposed a scheme for serological classification of E. coli strains which is modified later.
This modified Kauffman scheme is still being used. According to this, E. coli strains are
serotyped based up on their somatic (O), flagellar (H), and capsular (K) antigens. A serotype

R e v i e w o f l i t e r a t u r e
P a g e | 12
is defined as the combination of O and H antigens of an isolate (Nataro et al., 1998). A total
of 174 O antigens and 53 H antigens are identified presently (Croxen et al., 2013). However,
a small set of seotypes are associated with diarrhea. Serotyping cannot be used always for the
determination of pathotypes as these isolates being untypable or due to cross-reactivity
between antigens (Croxen et al., 2013). The test is tedious, costly and can be carried out
reliably by reference laboratories. Its sensitivity and specificity are limited also
(Nataro et al.,
1998).
Pulsed Field Gel Electrophoresis is considered as the gold standard typing method for
epidemiological investigations. It is commonly used to type isolates in phylogenetic analysis,
outbreak investigations and surveillance investigations (Croxen et al., 2013). The method is
time-consuming, laborious, needs technical expertise and is not portable to laboratories with
limited facilities (Croxen et al., 2013).
Multi-Locus Sequence Typing is the common method for typing of Diarrheagenic E. coli
strains (Croxen et al., 2013). In this, a small number of housekeeping genes are sequenced
and a unique allele is assigned. An allelic profile is then created for housekeeping genes and a
unique sequence type is assigned to each allelic profile. These sequence types are further
grouped into clonal complexes based on their similarity. EcMLST ( http://www.shigatox.net ) ,
Institut Pasteur Escherichia coli MLST database ( http://www.pasteur.fr/mlst ) and MLST
databases ( http://www.mlst.net ) are the three currently using MLST databases. A public
server which uses whole-genome sequencing to identify sequence type is started to use
recently ( http://cge.cbs.dtu.dk/services/MLST ) (Croxen et al., 2013) .
2.5 Evolution of Diarrheagenic E. coli
The comparative analysis of RNA sequences revealed that Salmonella and E. coli diverged
from a common ancestor
( Welch, 2006) . Shigella and E. coli have a high degree of sequence
similarity and phylogenetic studies revealed Shigella belongs to the species E. coli . However,
Shigella is being considered as a different genus mainly for historical reasons and its
association with Shigella infection ( Welch, 2006 ; Croxen et al., 2013).
The genome of E. coli has two splits; core genome and flexible gene pool. The core genome
is the shared and conserved segment while flexible gene pool contributes to the pathogenicity
of E. coli through the addition or loss of virulence genes. Pathogenic variants of E. coli
possess an extra of million base pairs of flexible gene content than of commensal variants.
This extra genetic content of virulence genes and fitness genes contributes to the

R e v i e w o f l i t e r a t u r e
P a g e | 13
pathogenicity ( Croxen et al., 2013) . Virulence is gained either by acquisition or by the loss of
genes through Horizontal Gene Transfer mechanisms. Mobile genetic elements such as
plasmids, transposons, insertion sequences and bacteriophages provide virulence and fitness
genes to new host either by integrating into the chromosomes or by self-replication ( Croxen
et al., 2013) . Genes that encode Colonization factors and enterotoxins of ETEC are carried on
plasmids while bacteriophages can transfer stx gene (Shiga toxin-encoding gene) to E. coli
strains. Loss of gene also favours the pathoadaptivity of the strains and thereby contributes to
the enhanced virulence. Loss of lysine decarboxylase in EIEC, ETEC, EPEC, STEC and
EAEC contributed to the pathoadaptivity of strains Croxen et al., 2013).
E. coli population can be grouped phylogenetically into five ie A, B1, B2, D and E. All
commensal strains belong to A group, but not all pathotypes are grouped together. ETEC
grouped under phylogenetic groups A and B1 while EAEC grouped in phylogenetic groups A,
B1, B2 and D ( Croxen et al., 2013) .
2.6 Classification of DEC
DEC is categorized into different pathotypes on the basis of their pathogenic features (Nataro
et al., 1998). Main pathotypes are Enteropathogenic E.coli (EPEC), Enterotoxigenic E. coli ,
Shiga toxin producing E. coli (STEC), Enteroaggregative E. coli (EAEC), Enteroinvasive E.
coli (EIEC), Diffusely Adherent E. coli (DAEC) and Adherent Invasive E. coli (AIEC)
( Croxen et al., 2013) . They differ in the site and mechanism of colonization as well as clinical
symptoms and outcomes among each other ( Croxen et al., 2013) .
2.7 Pathogenesis of DEC
2.7.1 Enteropathogenic E. coli (EPEC)
EPEC is a major cause of potentially fatal infant diarrhoea in the countries of developing
world ( Croxen et al., 2010) .The strains lack enterotoxin production and enteroinvasiveness as
the pathogenic mechanisms ( Deborah Chen et al.,2005) . They act through the different
pathogenic mechanism. It belongs to the family of Attaching and Effacing pathogens (A/E)
that can form attaching and effacing lesions on the intestinal epithelial cells (IECs) ( Croxen et
al., 2013) . The genetic determinants for this phenotype are located on Locus Enterocyte
effacement (LEE) which is a pathogenicity island of 35 kb (Nataro et al., 1998).
Based on the presence or absence of Plasmid E. coli Adherence Factor (pEAF), EPEC is
classified into typical and atypical subtypes. The typical EPEC (tEPEC) possess Bundle

R e v i e w o f l i t e r a t u r e
P a g e | 14
Forming Pili encoded by the plasmid EAF while atypical EPEC (aEPEC) lacks it ( Croxen et
al., 2013) . In contrast to tEPEC, aEPEC is a heterogeneous group which is highly prevalent in
asymptomatic children, endemic diarrhoea and in outbreaks ( Croxen et al., 2013) .
EPEC strains are transmitted from host to host via fecal-oral route through contaminated food
and water. Human carriers also can transmit the infection. The one and only reservoir for
tEPEC are humans while aEPEC strains have been isolated from human and animal sources
( Croxen et al., 2013) .
2.7.1.1 Pathogenesis
By definition, EPEC is diarrheagenic E. coli that produce a characteristic histopathology
known as attaching and effacing (A/E) lesions on intestinal wall and that do not produce
enterotoxins (Trabulsi et al.,2002, Croxen et al., 2013 ).
. In 1992, Donnenberg and Kaper
described a three-stage model for explaining the pathogenesis of EPEC (Nataro et al., 1998)
including Localized adherence to host cells, signal transduction and intimate attachment
( Croxen et al., 2013) . The hallmark of EPEC pathogenesis is the formation of A/E lesion
which can be observed in intestinal biopsy specimens from patients or infected animals
(Nataro et al., 1998). This phenotype is characterized by effacement of brush border
microvilli at the site bacterial attachment ( Croxen et al., 2013) . Following the attachment,
polymerization of actin filament occurs which leads to the formation of actin pedestals that
extend from the surface of epithelium into the lumen (Nataro et al., 1998; Croxen et al.,
2013 ). Moon et al described this phenotype and coined the term ‘attaching and effacing’ in
1983 (Nataro et al., 1998; Moon et al.,1983).
2.7.1.1.1 Localized adherence to host cells
Adherence of tEPEC strains to the host intestinal epithelium is mediated through bundle-
forming pilus (BFP). BFP are type IV pili that tether individual bacterium to one another to
form localized adherence pattern (LA)
( Croxen et al., 2013) . In this pattern, bacteria bind to
localized areas of cell surface and form compact microcolonies (bacterial clusters)
(Trabulsi
et al., 2002). The pili interconnect the bacteria within the microcolonies and thereby promote
their stabilization (Trabulsi et al., 2002). BFP are encoded by EAF plasmids which is a 60
MDa plasmid carrying bfp backbone, bfp operon and per ABC (Nataro et al., 1998). This
plasmid also enhances the expression of LEE chromosomal genes, probably through per ABC
(Trabulsi et al., 2002). In contrast, aEPEC strains do not harbour pEAF and thus do not
produce bfp which results in the formation of loose clusters of bacteria known as localized

R e v i e w o f l i t e r a t u r e
P a g e | 15
adherence-like pattern (LAL). Some strains of aEPEC display alternate adherence pattern like
diffuse adherence (DA) and aggregative adherence (AA) also. In addition to BFP, tEPEC
strains produce Lymphocyte inhibitory factor ( lif ) which contributes to epithelial cell
adherence ( Croxen et al., 2013) . This large surface protein is more common in tEPEC rather
than aEPEC strains. E. coli common pilus (ECP) is an additional adherence factor which has
the role in epithelial adherence as well as in bacterium-bacterium interaction. The T3SS
filament Esp A plays an important role in the brush border attachment in the strains lacking
bfp . Esp A does promote adherence in tEPEC also but in less efficient manner ( Croxen et al.,
2013) .
2.7.1.1.2 Signal transduction and intimate attachment
Adherence of EPEC to the epithelial cell induces a variety of signal transduction pathways
leading to the subversion of many cellular processes for the benefit of the pathogen (Nataro et
al., 1998; Croxen et al., 2013 ). The genes responsible for the signal transduction are carried
on LEE PAI which encodes Type3 secretion system (T3SS)
( Croxen et al., 2013) . LEE
contains 41 open reading frames (ORFs) of more than 50 amino acids arranged in five
polycistronic operons LEE1 to LEE5. These genes are separated into three functional
domains –region encoding the proteins of intimate adherence, region encoding secreted
proteins (Esp- EPEC secreted proteins) and their putative chaperons and the region encoding
T3SS (Deborah Chen et al., 2005).The function of T3SS is to secrete protein components of
the translocon (Esp A, Esp B, Esp D) and to drive effectors into host cells ( Croxen et al.,
2013) . A/E lesion is formed by the subversion of actin dynamics within the host cells
mediated by the interaction between intimin and bacterial translocated intimin receptor Tir
pathogen (Nataro et al., 1998). Intimin is a 94-kDa outer membrane protein encoded by eae
gene located on LEE which is found in all A/E pathogens (Nataro et al., 1998) and is later
inserted into the bacterial outer membrane ( Clements et al., 2012) . Tir, the intimin receptor is
translocated to the cell membrane by T3SS (Moon et al., 1983). Interaction of Intimin with
Tir causes its clustering and which is then phosphorylated by host Tyrosine kinases ( Croxen
et al., 2010) . Phosphorylated Tir recruits Nck to the site of attachment which activates neural
Wiskott-Aldrich syndrome protein (N-WASP) and the actin-related protein 2/3(ARP2/3)
complex to mediate actin rearrangements and pedestal formation ( Croxen et al., 2010) .

R e v i e w o f l i t e r a t u r e
P a g e | 16
2.7.1.1.3 Role of secreted proteins in the pathogenesis
The genome of EPEC strains contains seven LEE-encoded effector genes and several Non-
LEE effector genes which are delivered into host cells through T3SS. There are seven LEE-
encoded proteins which are Tir, Map, Esp F, Esp G, Esp Z, Esp H and Esp B. Effacement of
microvilli and recruitment of cytoskeletal proteins for pedestal formation are the functions of
Tir protein. It is the receptor for the protein Intimin. Map (Mitochondrial associated protein)
stimulates the formation of filopodia and epithelial barrier disruption along with
mitochondrial dysfunction. Both Esp F and Esp G affect aquaporin localization which leads
to diarrhea (Croxen et al., 2013). Esp G interacts with tubulin and thereby alter host
cytoskeletal components while Esp F disrupts tight junctions and localizes to mitochondria.
The function of Esp Z is host cell survival whereas Esp H participates in actin signalling
during pedestal formation. This also affects filopodium formation. Both Esp H and Esp B
prevent phagocytosis of EPEC by macrophages. Several Non-LEE (Nle) encoded effectors
are also involved in pathogenesis and a number of these effectors are involved in dampening
the host immune response also. Nle A, Nle B, Nle C, Nle D,Nle E, NleH and Esp J are the
known Nle effectors of EPEC. The functions of Nle A are altering the host protein secretion,
tight junction injury and inhibition of vesicle trafficking. Nle B, Nle C, Nle D, Nle E and Nle
H can inhibit NF- KB activation. Esp J has immunomodulatory functions and antiphagocytic
activity (Croxen et al., 2013).
Some EPEC strains also have type V secreted system which plays a significant role in the
virulence. Esp C is a type V secreted , Per activated serine protease auto transporter which
has enterotoxic activity. It causes increased lysozyme resistance of the strains and helps in
biofilm formation also (Croxen et al., 2013).

R e v i e w o f l i t e r a t u r e
P a g e | 17
Figure 2. Pathogenesis of EPEC and EHEC induced diarrhea
2.7.1.1.4 Mechanism of diarrhea
Mechanism of diarrhea production by EPEC strains is not yet discovered completely and it is
expected to be due to the combination of different mechanisms (Croxen et al., 2013). The
effacement of microvilli could lead to diarrhea via malabsorption (Nataro et al., 1998).
However, the speed of onset of diarrhoea implies a secretory mechanism rather than
malabsorption. Nevertheless, the decrease in the absorptive surface of intestinal epithelial
cells due to the effacement of microvilli could lead to diarrhea through intervention with
proper absorptive channels (Croxen et al., 2013). T3SS effectors can impact various water ion
channels of intestinal epithelial cells and thereby contribute to diarrhea. EPEC can affect
intracellular mediators of intestinal ion transport such as calcium, PKC, inositol phosphates,
and tyrosine kinase (Croxen et al., 2013; Nataro et al., 1998). A significant decrease in the
transmembrane potential was observed in epithelial cells when infected with EPEC. This
suggests that EPEC can stimulate either an inward flow of positive ions or an outpouring of
negative ions across the membrane (Nataro et al., 1998). Disruption of tight junctions by Esp
F, Esp G and Map leads to increased intestinal permeability which may contribute to
diarrhoea. Esp G disrupts chloride transport across apical membrane resulting in decreased
Cl –
/OH –
exchange activity (Croxen et al., 2013). Tir, Map, Esp F and Esp H inhibit sodium-D-
glucose transporter (SGLT1) which causes fluid uptake from the intestine (Croxen et al.,
2013).

R e v i e w o f l i t e r a t u r e
P a g e | 18
2.7.1.2 Clinical manifestations
In EPEC infection, profuse watery diarrhoea is often accompanied by low-grade fever,
vomiting and dehydration
(Nataro et al., 1998). It causes primarily acute infection, however
many cases develop into the persistent infection which requires hospitalization
(Croxen et al.,
2013).
2.7.2 Enterotoxigenic E. coli (ETEC)
ETEC is a major cause of traveler’s diarrhea and is endemic in many of the developing
countries (Cai et al., 2016). This diverse pathotype can cause significant fatality in children
and can be isolated from carriers (symptomatic as well as asymptomatic) (Croxen et al.,
2013). ETEC is defined as the diarrheagenic E. coli that can produce at least one member of
two defined group of enterotoxins; heat stable toxin (ST) and heat labile toxin (LT)
(Nataro et
al., 1998). In addition, it carries a diverse set of colonization factors (CFs) which aid in the
adherence of the strains to intestinal epithelium (Croxen et al., 2013).
2.7.2.1 Pathogenesis
ETEC causes disease by colonizing in the small intestine through the attachment to the host
epithelial lining by colonization factors and then produce enterotoxins that contribute to
typical ETEC induced diarrhea. The organism acquires pathogenesis through plasmid-born
toxins and virulence factors (Croxen et al., 2013). The strains may express either LT or ST or
both (Nataro et al., 1998).
2.7.2.1.1 Adhesins
Colonization factors are surface antigens which are either fimbrial, afimbrial, helical or
fibrillar structures encoded on virulence plasmids and are also known as coli surface antigens
(CS)
(Croxen et al., 2013). A total of 23 CFs have been characterized yet which are
subdivided into different families and are named CFA/1 and CS1 to CS22 (Rodas et al.,
2009). Most common CFs found among ETEC strains isolated worldwide are CFA/1, CS1,
CS2, CS3, CS4,CS5, CS6, CS7, CS14, CS17, and CS21 (Qadri et al,.2005) CS (CFs) of 30%
to 50% ETEC isolates are yet to be identified (Croxen et al., 2013)
. These molecules bind to
different receptors on the surface of the host cell. The receptors of CS6 are fibronectin and
sulfatide while CFA/1 binds to glycoprotein and glycosphingolipid on the host cell surface of
small intestine (Croxen et al., 2013) . Pilin is the predominant immunogen found on the
majority of the CFs (Nataro et al., 1998) .

R e v i e w o f l i t e r a t u r e
P a g e | 19
The adhesins other than CF are tia and tib which facilitate more intimate attachment ( Croxen
et al., 2010) . It is proved that tib has the role in biofilm formation and autoaggregation of
cells. Etp A is another protein that helps in adhesion to the epithelial cell which is exposed at
the tip of the flagellum to facilitate the attachment (Croxen et al., 2013) .
2.7.2.1.2 Enterotoxins
Enterotoxin genes are encoded on the plasmids where CF genes are usually encoded (Nataro
et al., 1998) . ETEC diarrhoea is attributed to the secretion of enterotoxins such as heat stable
toxin (ST) and heat labile toxin (LT)
( Croxen et al., 2010) .
2.7.2.1.2.1 Stable toxin (ST)
Two variants of ST can be found commonly. The variant found on the strains that colonize
human intestine is ST a (ST-1) while that found on the strains isolated from the animal source
is ST b (ST-11). Two STa variants have been found in strains that cause human disease are
STp and STh (Croxen et al., 2013). STs are small monomeric toxins of 18-19 amino acids
length that contain multiple cysteine residues and whose disulfide bonds confer heat stability
to the toxin (Nataro et al., 1998; Croxen et al., 2013). As this toxin mimics the hormone
Guanylin, it can bind to guanylyl cyclase C (GC- C) receptors on the apical membrane of the
intestinal epithelium
(Nataro et al., 1998; Croxen et al., 2013). The binding causes the over
activation of GC-C which leads to the accumulation of cGMP. Accumulated cGMP indirectly
promote Cystic Fibrosis Transmembrane Receptor (CFTR) to secrete chloride into the
intestinal lumen. It also inhibits the sodium hydrogen exchanger and thereby prevents
absorption. Fluid and chloride secretion into the lumen and impaired fluid absorption are
considered as the reasons for watery diarrhoea in ST induced disease (Croxen et al., 2013).
2.7.2.1.2.2 Labile Toxin (LT)
Labile toxins are classified into two, LT-1 and LT-11, based on their B subunit receptor
affinity and immune properties (Croxen et al., 2013). LT-1 is commonly associated with both
animal and human illness while LT-11 is found primarily in animals. However, it can be
found in isolates from human sources rarely (Nataro et al., 1998). LT-1 genes are encoded on
virulence plasmids whereas LT-11 genes located on chromosomes. LT-11 gene may have been
acquired by phages also (Croxen et al., 2013). These are oligomeric toxins are related to
Cholera enterotoxin in structure and functions (Nataro et al., 1998).

R e v i e w o f l i t e r a t u r e
P a g e | 20
It is a multimeric AB
5 toxin, with a single-A subunit and five identical B subunits (Cai et al.,
2016). ‘A’ subunit is responsible for the enzymatic activity while B subunits which are
arranged in a ring or ‘doughnut’ help in the binding of the toxin to intestinal glycoproteins
(Nataro et al., 1998; Croxen et al., 2013). B subunits specifically bind to the GM
1 ganglioside
at lipid raft to deliver the catalytic ‘A’ subunit inside the cell. Inside the cell, it is transported
through the endoplasmic reticulum and delivered to the host cytoplasm (Croxen et al., 2013).
In the cytoplasm, it ADP-ribosylates G
s? and thereby inhibits its GTPase activity which
increases the cAMP levels. Increased cAMP opens CFTR, resulting in the electrolyte and
fluid loss into the intestinal lumen. Fluid loss can be resulted due to the intestinal barrier
disruption by LT (Croxen et al., 2013).
LT can also help in the adherence to the epithelial cells through the activation of host
signalling pathways. In addition, it can suppress the expression of antimicrobial peptides
through the activation of Protein kinase A (PKA) (Croxen et al., 2010; Croxen et al., 2013).
2.7.2.1.3 Other virulence factors
It has been recently reported that some ETEC strains can produce EAST1 also, but the role
of which in diarrhea is not yet elucidated (Nataro et al., 1998). Eat A, a serine protease
autotransporter of Enterobacteriaceae (SPATE), which contributes to LT delivery by
degrading Etp A (Croxen et al., 2013). It also accelerates fluid build-up by cleaving Cathepsin
G (Croxen et al., 2010). The cleavage of Etp A modulates the adherence of the pathogen to
the host cell ( Clements et al., 2012) . The other virulence factors include Cyl A, pore-forming
cytotoxin, and Cex E, a small 126 kDa secreted protein (Croxen et al., 2010; Croxen et al.,
2013).

R e v i e w o f l i t e r a t u r e
P a g e | 21
Figure 3. Pathogenic mechanism of a) ETEC b) EAEC infections
2.7.2.2 Clinical manifestations
ETEC causes mild to severe diarrhea which is usually watery, non-bloody and without pus or
mucus. The clinical presentation is very similar to that of cholera and can rapidly lead to
dehydration (Croxen et al., 2013). The onset is abrupt with short incubation period (14-50
hours) and usually self-limiting (Nataro et al., 1998). The illness is accompanied by
headache, fever, abdominal cramping, nausea and vomiting in minority of patients. The
duration of diarrhea is usually about 3-5 days (Croxen et al., 2013).
2.7.3 Enteroaggregative E. coli (EAEC)
EAEC is the heterogeneous category of emerging enteric pathogen associated with acute or
persistent diarrhea in children. It is defined as the diarrheal pathogen which demonstrates
characteristic ‘stacked brick’ aggregative adherence when cultured with Hep-2cells ( Kaur et
al ., 2010). It is the second most common agent of traveler’s diarrhea after ETEC (Croxen et
al., 2010). It causes persistent diarrhea in children where EAEC is endemic and also in

R e v i e w o f l i t e r a t u r e
P a g e | 22
patients with HIV infection (Croxen et al., 2013). The prevalence of the pathogen in epidemic
and endemic disease is becoming well recognized (Clements et al., 2012).
2.7.3.1 Classification
Based on the presence or absence of ‘ aggR’ , the EAEC strains are classified into typical or
atypical strains. The strains those possess aggR gene are termed as ‘typical’ strains whereas
strains those lack aggR are called as ‘atypical’ strains (Croxen et al., 2013). The gene is the
master regulator of EAEC virulence that controls the expression of adherence factors, a
dispersin protein, and a large cluster of genes encoded on the chromosome of EAEC (Huang
et al., 2006).
2.7.3.2 Pathogenesis
The pathogenesis of EAEC is really complex and is not fully understood. The major obstacle
in understanding the mechanism is diversity and heterogeneity of the strains ( Kaur et al .,
2010). The stages of the mechanism are 1) Initial adherence to the intestinal mucosa 2).
Biofilm formation 3) Induction of inflammatory response and release of toxins (Jensen et al.,
2014).
2.7.3.2.1 Adherence
Adhesion to the intestinal epithelium is mediated by fimbriae namely aggregative adherence
Fimbriae (AAF). Four variants of AAF have been found in the strains of EAEC with different
structures of pilin units (AAF/I to /AAF/IV) (Jensen et al., 2014). The genes encoding these
fimbriae are located on pAA (Plasmid aggregative adherence), a plasmid of 60-65MDa. The
genes are aggA (AAF /I), aafA (AAF/II), agg-3 (AAF/III) and agg4A (AAF/IV). AAF/I is
responsible for the aggregative phenotype while AAF/II allow adherence to the intestinal
mucosa. The fimbriae AAF/III functions as adhesion (Croxen et al., 2013; Huang et al.,
2006). AAF/I has the role in haemagglutination exhibited by some EAEC strains (Huang et
al., 2006). Adherence is also associated with afimbrial adhesins which are membrane-
associated proteins (MAP) of 18, 20, 58 kDa (Croxen et al., 2013; Huang et al., 2006). They
have the role in haemagglutination also (Huang et al., 2006).
Dispersin is a secreted low molecular weight protein which is responsible for mediating
dispersal of EAEC across the intestinal mucosa. This increases the efficiency of adherence
and aggregation. It is a 10 kDa protein encoded by ‘ aap ‘ gene that lies immediately upstream
of the aggR (Huang et al., 2006). This protein is also termed as Aap (Antiaggregation protein)

R e v i e w o f l i t e r a t u r e
P a g e | 23
and is secreted to the surface of EAEC that can bind non covalently to negatively charged
lipopolysaccharide of the outer membrane. So the positively charged AAF is free to splay out
from the surface and bind the distant site (Harrington et al., 2006). Since the protein is highly
immunogenic, it is considered as a potential vaccine candidate ( Kaur., 2010) .
The strains that lack AAF possess alternate adhesion pilin encoded by hdaA which is
regulated by aggR ( Kaur., 2010) . In such strains, adherence is also associated with hraI gene
which encodes heat resistant agglutinin (Croxen et al., 2013; Bhargava.,2009).
2.7.3.2.2 Biofilm formation
The second stage of EAEC pathogenesis involves the production of mucus layer which is
followed by the formation biofilm (Jensen et al., 2014). The pathogen stimulates intestinal
epithelium to produce mucus layer over the enterocytes (Cennimo et al.,2007). It contributes
to persistent infection by allowing the bacteria to evade the local immune system and by
preventing the transport of antibacterial factors such as antibiotics
(Jensen et al., 2014).
Biofilm formation is also regulated by aggR and requires several other genes such as fis ,
yafk,Eil A,air, shf , aatA and set 1A (Jensen et al., 2014). The gene fis is located on the
chromosome that encodes a DNA binding protein involved in growth phase-dependent
regulation and yafk a 28kDa secreted protein. These genes have a role in the regulation of
AAF expression (Huang et al., 2006; Jensen et al., 2014).
2.7.3.2.3. Induction of inflammatory response and release of toxins
The third stage of EAEC pathogenesis involves cytotoxic effects by the release of toxins, and
an elicitation of the inflammatory response, mucosal activity and intestinal secretion. The
effects of toxins include microvillus vesiculation, enlarged crypt opening and increased
epithelial cell extrusion (Croxen et al., 2013). The toxins produced by the strains are plasmid
encoded toxin (Pet), heat stable toxin (EAST1), Shigella enterotoxin (ShET1) and Pic
(Croxen et al., 2013; Kaur., 2010) . Pet is a SPATE that cleaves alpha fodrin to disrupt actin
cytoskeleton which results in the elongation and exfoliation of the epithelial cell (Croxen et
al., 2010; Kaur., 2010) . EAST1 is encoded by astA and is similar to the stable toxin of ETEC.
ShET1 induces intestinal cAMP and cGMP mediated secretion (Croxen et al., 2013). Pic is a
mucinase that interferes with the integrity of the mucus membrane and induces serum
resistance and haemagglutination (Jensen et al., 2014).

R e v i e w o f l i t e r a t u r e
P a g e | 24
Induction of inflammatory response depends upon the host innate immune system and the
strain. EAEC stimulates the production of IL-8 and CCL-20 by adhering to intestinal
epithelium, which recruits neutrophil and induces inflammatory diarrhoea (Croxen et al.,
2013).
2.7.3.3 Clinical manifestations
EAEC presents with watery secretory diarrhoea which is often mucoid and occasionally
associated with low-grade fever, nausea, vomiting and abdominal pain. It can cause bloody
diarrhoea also (Jensen et al., 2014). Persistent EAEC infections can cause malnourishment
in children in developing countries as the chronic inflammatory response can damage the
intestinal epithelium and its ability to absorb nutrients. Development of Irritable bowel
syndrome has been reported increasingly after acute infections with EAEC (Croxen et al.,
2013).
2.7.4 Shiga toxin producing E. coli (STEC)
Shiga toxin producing E. coli , also known as Verocytotoxin producing E. coli (VTEC), is a
food-borne zoonotic pathogen associated with bloody Haemorrhagic Colitis (HC) and
Haemolytic Uremic Syndrome (HUS)
(Croxen et al., 2013; Nguyen et al., 2012) . It is a
highly infectious A/E pathogen (Nataro et al., 1998). Even though it encompasses more than
400 serotypes, only a small subset can cause diseases in humans (Croxen et al., 2013).
Enterohaemorrhagic E. coli (EHEC) serotype O157; H7 is a subset of STEC that is
responsible for outbreaks of HC and HUS ( Nguyen et al., 2012) . HC is a distinctive
gastrointestinal illness characterized by severe crampy abdominal pain, watery diarrhoea
followed by glossy bloody diarrhoea and little or no fever which is clinically distinct from
shigellosis (Nataro et al., 1998; Croxen et al., 2013). Haemolytic Uremic Syndrome (HUS) is
defined as the triad of acute renal failure, thrombocytopenia, and microangiopathic
haemolytic anaemia. It is preceded typically by bloody diarrhoea (Nataro et al., 1998). It is
estimated that 10% of STEC infection progresses to HUS which is the most common cause of
acute renal failure in children. The case fatality rate of HUS in such cases is ranging from 3%
to 5%. It develops into neurological complications such as seizure, stroke and coma in 25%
of the patients with HUS (WHO, 2018). Non O157STEC strains such as O26, O45, O103,
O111, O121, and O145 are also associated with severe human illness. These strains are
otherwise known as the “Big 6″, as they are the most non-O157 STEC human pathogens
(Croxen et al., 2013).

R e v i e w o f l i t e r a t u r e
P a g e | 25
Cattles are the key reservoir for EHEC strains which colonizes the distal ileum and large
bowel of warm-blooded animals and human (Croxen et al., 2010; WHO, 2018). It is
transmitted to the humans through contaminated food such as raw or undercooked meat
products, raw milk and contaminated vegetables and through direct contact (WHO, 2018;
Robinson et al., 2006) . The ability of STEC to form Viable-but-non-culturable cells (VBNC)
when faced with the environment with stress, may increase the ability to produce infection in
low dose. VBNC can be formed on food and is capable of producing Shiga toxin. However,
the impact of VBNC mediated infection is not yet estimated (Croxen et al., 2013).
2.7.4.1 Pathogenesis
EHEC strains harbour Shiga toxin 1or 2 gene as the main virulence factor which is acquired
by lambdoid bacteriophage and is inserted into the chromosome. Other virulence factors are
encoded in the chromosome and on a plasmid of 60MDa. A 35kb LEE pathogenicity island
which confers A/E phenotype is present in all strains of EHEC. It contains genes encoding
intimin, the secreted proteins Esp A, Esp B and a type III secretion system (Nataro et al.,
1998).
2.7.4.1.1 Virulence factors
2.7.4.1.1.1 Shiga toxin
Shiga toxin is the key virulence factor in STEC causing HUS which can be classified into two
immunologically non-reactive groups called Stx 1 and Stx 2. Both Stx 1 and Stx 2 are again
subtyped into three (a,c and d) and seven (a to g) respectively (Nataro et al.,1998; Croxen et
al., 2013). STEC can harbour either stx1 and /or stx 2 or a combination of stx 2 subtypes. Stx
2 variants cause more severe illness in human beings than stx1variants (Croxen et al., 2013).
Shiga toxin is an AB
5 toxin which is composed of two major subunits designated as A and B
Croxen et al., 2010; Nguyen et al., 2012) . The subunit A consists of two peptides linked by
disulphide bonds, namely A
1 and A
2 , among which A
1 contains enzymatic activity while A
2
bind to pentameric subunit B (Nataro et al., 1998). The B subunit binds specifically to
globotriaosylceramide 3(Gb 3) of Paneth cells of epithelial cells (Croxen et al., 2010).
Further, it is internalized and trafficked to the cytoplasm through Golgi apparatus and
endoplasmic reticulum by retrograde pathway (Croxen et al., 2013). The toxin is then
absorbed into the bloodstream, disseminated and binds to the tissues and cell types expressing
Gb3 receptors ( Nguyen et al., 2012) . The A subunit exhibits the N-glycosidase activity which

R e v i e w o f l i t e r a t u r e
P a g e | 26
removes adenine residue from 28rRNA and thereby inhibits protein synthesis (Nataro et al.,
1998). The cleavage also induces apoptosis, cell necrosis and thereby cell death (Croxen et
al., 2010).The renal glomerular epithelium expresses the higher level of Gb3 receptors which
makes the toxin binds to it and causes acute renal failure ( Nguyen et al., 2012) .
2.7.4.1.1.2 Cytolethal distending toxin
The cluster of genes ‘ cdtABC’ encodes Cytolethal distending Toxin which triggers cell arrest
by damaging host DNA. It is found frequently on EHEC O157: H7, but less often on SFO157
NM strains (Croxen et al., 2013).
2.7.4.1.1.3 Haemolysin
The exact role of haemolysin in the pathogenesis of EHEC is unclear. It is a pore-forming
toxin encoded by ehx or hly which is found to be cytotoxic to endothelial cells and thereby
contribute to HUS. In addition, it has been shown to be associated with outer membrane
vesicles which prolong its activity. It is found to be inactivated by the autotransporter Esp P
(Croxen et al., 2013).
2.7.4.1.1.4 Autotransporter
ESp is serine protease that cleaves human coagulation factor V, pepsin A, complement and
haemolysin. It is multifunctional autotransporter associated with severe disease (Croxen et
al., 2013).
2.7.4.1.2 (a) Attachment
The initial attachment of EHEC to the epithelial cells is mediated by haemorrhagic coli pilus
which is a type IV pilus (Croxen et al., 2010). It is responsible for twitching motility and
biofilm formation. Fimbriae YcbQ and lpf (Laminin-binding protein and long polar fimbriae)
contribute to attachment to extracellular matrix (Croxen et al., 2013).
Intimate attachment is afforded by intimin and Tir which mediate actin assembly and there by
A/E phenotype (Croxen et al., 2013).
2.7.4.1.2 (b) Attachment and virulence of non-LEE STEC
Unique adhesion such as lpf2 homolog, STEC auto agglutinating adhesion (saa), Sab(is a
STEC autotransporter associated with biofilm formation) are involved in the attachment of
the organism to the colon. After attachment it is invaded to the cell with help of flagellar

R e v i e w o f l i t e r a t u r e
P a g e | 27
antigen H2 and invasion process may involve lipid rafts. Subtilase cytotoxin encoded by
subAB on the virulence plasmid is found to be a regulator of stress response in the
endoplasmic reticulum and which ultimately leads to cell death (Croxen et al., 2013).
2.7.4.2. Clinical manifestations
STEC infections can range from mild watery diarrhoea to bloody diarrhea (Haemorrhagic
colitis), with a risk for development of HUS. Diarrhoea can be associated with fever,
abdominal pain and vomiting followed by haemorrhagic colitis. HUS may develop between 5
days and 13 days after the initial symptoms of diarrhoea (Croxen et al., 2013).
The complications of STEC infection include cholecystitis, colonic perforation, post
haemolytic biliary lithiasis, haemorrhagic cystitis, intussusception, pancreatitis, post infection
colonic stricture, appendicitis, hepatitis, pulmonary oedema, rectal prolapse, myocardial
dysfunction and neurological abnormalities (Nataro et al., 1998).
2.7.5. EAEC strains with ‘stx’gene (STEAEC)
EAEC 0104: H4 strains that acquired typical EHEC phenotype are an enteric pathogen of
significant public health importance. It is a hybrid population which expressed both Shiga
toxin production and aggregative adherence. It can cause infections that develop into
Haemolytic Uremic syndrome (HUS). A foodborne outbreak caused by this distinct
population was reported at the beginning of May 2011 in Germany with a mortality rate of
1%. The ability of the strains to adhere to the intestinal epithelium may facilitate the
absorption of Shiga toxin which leads to the progression of HUS (Bielaszewska et al., 2011).
2.7.6 Enteroinvasive E. coli (EIEC)
EIEC is a facultative intracellular pathogen which is biochemically, genetically and
pathogenically closely related to Shigella (Nataro et al., 1998; Croxen et al., 2013). EIEC and
Shigella are the causative agents of bacillary dysentery or shigellosis (Croxen et al., 2013).
These strains are commonly lactose nonfermenting nonmotile and lysine decarboxylase
negative (Nataro et al., 1998).
2.7.6.1 Pathogenesis
These highly infectious strains replicate in the intracellular milieu of intestinal epithelial
cells. They are adaptable to face various stresses during the course of infection such as low
gastric pH, temperature changes, oxygen availability and osmolarity. Essential virulence
factors are encoded on chromosome and plasmid loci of the organism (Croxen et al., 2013).

R e v i e w o f l i t e r a t u r e
P a g e | 28
The pathogenic mechanism of EIEC includes i) epithelial cell penetration ii) lysis of
endocytic vacuole iii) intracellular multiplication iv) directional movement through the
cytoplasm v) extension into adjacent epithelial cells (Nataro et al., 1998).
EIEC strains attach to the colonic mucosa. The virulence factors required for the invasion is
located on the 140 MDa plasmid which is designated as pINV. The main plasmid-encoded
virulence factors belong to mxi and loci, which encode Type III secretion system. This
secretion system secrets Ipa proteins such as Ipa A, Ipa B, Ipa C and Ipa D. Among these, Ipa
B, Ipa C, and Ipa D are effectors of invasion phenotype. Ipa B lyse the phagocytic vacuole
and induce apoptosis of macrophages (Nataro et al., 1998).
Figure 4. Pathogenic mechanism of EIEC infection
2.7.6.2. Clinical manifestations
EIEC infection is characterized by watery diarrhea which is followed by dysentery with
blood and mucus in the stool (Nataro et al., 1998). The early stage of infection is
accompanied by fever, malaise, fatigue and anorexia (Croxen et al., 2013).

R e v i e w o f l i t e r a t u r e
P a g e | 29
2.8. Diagnosis
2.8.1 EPEC
O:H serotyping was used to diagnose EPEC infections in earlier times. It is replaced by other
techniques as the knowledge of this pathogen has increased (Croxen et al., 2013) . There are
two approaches to detect EPEC in the laboratory: Phenotypic and genotypic. Phenotypic
methods include cell cultures and fluorescent microscopy whereas DNA hybridization and
PCR are the phenotypic tests (Nataro et al., 1998) .
2.8.1.1 Phenotypic tests
The A/E phenotype can be identified by using cultured Hep-2 or HeLa cells and antibody to
?-actinin of IEC conjugated to FITC or Rhodamine. The phenotype can also be identified by
electron microscopic examination of intestinal biopsy specimens or cultured epithelial cells
incubated with EPEC (Nataro et al., 1998) .
2.8.1.2 Genotypic tests
DNA probes and PCR primers have been developed to detect A/E and EAF plasmid. A/E is
detected by using primers or probes for ‘eae’ gene while EAF probe or bfp sequences indicate
the presence of EAF plasmid. Typical EPEC possess both ‘ eae ‘gene and bfp ‘gene’ whereas
atypical EPEC harbours only ‘eae’ gene (Nataro et al., 1998) .
2.8.2 ETEC
Since ETEC strains are defined by the presence of enterotoxins, its diagnosis depends upon
the detection of either LT and or ST. Even though serotyping was used for diagnosis in earlier
times, it is abandoned later as it was found to be of limited use. Rabbit ileal loop model for
LT and infant mouse assay for ST were the physiological assays which were considered as the
gold standard tests for ETEC diagnosis. Detection of LT was later replaced by tissue culture
cell line methods such as Y1 adrenal cell assay and Chinese hamster ovarian cell assay.
Immunosorbent assay was developed for the detection of LT thereafter, which is replaced by
more specific and more sensitive molecular methods such as PCR. Colonization factors can
also be detected by molecular techniques
( Qadri et al., 2005).

R e v i e w o f l i t e r a t u r e
P a g e | 30
2.8.3 EAEC
Hep-2 assay and molecular detection of specific virulence factors are the methods for the
diagnosis of EAEC, of which Hep-2 assay is being considered as the gold standard test. For
performing the Hep-2 assay, culture five colonies per patient in static Luria broth at 37 7
C and
then infect semi confluent Hep 2 cells for 3 hours and look for the aggregative adherence
(AA). EAEC produces hallmark ‘stacked brick’ like appearance which confirms the presence
of EAEC (Nataro et al., 1998; Croxen et al., 2013) . However, this assay does not
differentiate pathogenic and non-pathogenic strains since both strains produce the
characteristic appearance in the Hep-2 cell. Amplification of either plasmid carried aatA or
chromosomally carried aaiC by multiplex PCR is found to be sufficient to detect
diarrheagenic EAEC strains in many studies (Croxen et al., 2013) . Detection of pCVD432
gene segment by PCR is being used to detect diarrheagenic strains of EAEC with more
specificity and sensitivity ( Weintraub et al., 2007) .
2.8.4 STEC
STEC O157: H7 (EHEC) can readily be distinguished from other E. coli strains by culturing
it on sorbitol MacConkey agar (SMAC) due to its sorbitol non fermenting property. But this
is not applicable for the detection of non O157: H7 as it often ferments sorbitol. Shiga toxin
testing is recommended for the diagnosis of non O157 STEC infection (Croxen et al., 2013).
2.8.5 EIEC
Sereny test or Guniea pig keratoconjunctivitis is the classical phenotypic assay to identify the
strains by determining its invasiveness property. PCR based detection of invasion plasmid
antigen H (ipa H) gene and invasion associated locus (ial) gene can also be used to diagnose
EIEC infections. Due to their close relatedness, it is difficult to distinguish between EIEC and
Shigella strains. Genotypic assay such as MLST provides the discrimination with higher
resolution (Croxen et al., 2013).
2.9 Epidemiology of pathotypes
2.9.1 EPEC
Initially, EPEC was an important cause of infantile diarrhoea in developed countries, but over
the years, it became more prevalent in developing countries (Croxen et al., 2013). The most
striking feature of EPEC infection is the age distribution seen in patients. It is more prevalent

R e v i e w o f l i t e r a t u r e
P a g e | 31
in children than adults. The decreased occurrence in adults due to the loss of EPEC specific
receptors with the age or development of immunity. Atypical EPEC is found to be more
common in both developed and developing countries than typical EPEC. It is one of the
common causes of persistent diarrhoea (Croxen et al., 2013).
Humans are the only known reservoir for tEPEC while both animals and humans are the
sources of infection with aEPEC. It is transmitted via the fecal-oral route through
contaminated surfaces, weaning fluids and human carrier. The infectious dose of the natural
infection is not yet known (Croxen et al., 2013).
2.9.2 ETEC
ETEC is associated with weanling diarrhea and traveler’s diarrhea in children in the countries
of developing world (Nataro et al., 1998). The GEMS case-control study reported ST positive
ETEC is more associated with infantile diarrhea. It is endemic in developing countries of
Latin America, Africa, and certain regions of Asia. However, ETEC caused an epidemic
outbreak in Bangladesh during major flood (Croxen et al., 2013). It is associated with
sporadic outbreaks in developed countries such as the United States and Denmark. Traveler’s
diarrhea causes significant morbidity and mortality among the children of these countries
(Croxen et al., 2013). It commonly occurs in wet and warm months and for the first time
visitors to high risk, developing countries. It is usually transmitted through contaminated food
and water (Nataro et al., 1998). The infectious dose is comparatively high, it is thought to be
10 6
-10 8
organisms (Croxen et al., 2013) .
2.9.3 EAEC
Many studies reported the association of EAEC with persistent diarrhea which lasts for ?14
days. It is also associated with sporadic diarrhea, endemic diarrhoea and outbreaks (Nataro et
al., 1998). It causes diarrhoea in immunocompromised patients especially in AIDS patients
(Weintraub
et al., 2007). The reservoir of EAEC infections still has not been determined, but
it is generally accepted to be human. It is transmitted through contaminated food and water
by the fecal-oral route. It is the most frequently detected pathotype among DEC. It also
causes diarrhoea in travellers returning from developing countries (Jensen et al., 2014).

R e v i e w o f l i t e r a t u r e
P a g e | 32
2.9.4 STEC
EHEC O157: H7 is the most common serotype of STEC that is associated with diarrhea.
However, non O157:H7 strains are also found to be associated with diarrhoeal episodes
especially sporadic cases and outbreaks (Croxen et al., 2013). Surveillances programmes
conducted in the developed countries such as United States, Canada, Australia, Europe,
Ireland and Denmark reported the incidence of both EHEC O157: H7 and non O157: H7
infections among the population (CDC, 2012, NESP, 2012, Vally et al.,2012, ECDP,2011).
The highest worldwide incidence of HUS under the age of five is reported in Argentina which
may be due to the meat consumption, playing in the recreational water and poor personal
hygiene
(Croxen et al., 2013). The reported cases of STEC infections among the population
of India are limited (Kumar et al., 2014). Transmission occurs through the fecal-oral route
and from person to person (Nataro e al., 1998). The infectious dose is thought to be less
(Croxen et al., 2013). The reservoir of these strains is the fecal flora of animals including
cattle, sheep, pigs, dogs, goats and chicken (Nataro e al., 1998).
2.9.5 EIEC
Transmission of EIEC is mediated via contaminated food and water or direct person to
person. The epidemiology of EIEC is not well documented as it causes less severe infections
(Croxen et al., 2013).
2.10 Treatment
Most of the EPEC infections are self-limited and it can be effectively treated with Oral
Rehydration Therapy. Persistent infection may require the use of antibiotic resistance.
Antibiotic resistance as well as its cost and supply limit the use of antibiotic in developing
countries (Croxen et al., 2013).
ETEC infections are self-limiting, however, oral rehydration and maintaining electrolyte and
fluid balance through diet is very effective. Antisecretory drugs such as loperamide can be
used to reduce the number of stools and also along with antimicrobial agents. Antibiotics
such as fluoroquinolones, azithromycin, rifamixin are being used to treat traveler’s diarrhea
(Croxen et al., 2013).
EAEC infections are usually treated with fluoroquinolones and ciprofloxacin, however, the
selection of antibiotics as the drug of choice varies according to the antibiotic resistance of
pattern of the particular region (Croxen et al., 2013).

R e v i e w o f l i t e r a t u r e
P a g e | 33
STEC infections are usually self-limiting and resolve mostly in one week. Currently, there are
no measures to prevent the development of HUS following STEC infections. Intravenous
fluid administration can improve the renal protection against oligoanuria in patients under the
age of 18. Monitoring of platelet and renal function are suggested to improve the clinical
manifestations of the disease. The usage of antibiotics, antimotility drugs, pain relief drugs
are not recommended during thecourse of illness (Croxen et al., 2013). The use of antibiotics
in STEC infection is not recommended as it causes a potential increase in the risk of
developing HUS. It increases the toxin production or release by lysis of bacteria. In addition,
it kills other intracolonic bacteria thereby increases the systemic absorption of toxin (Nataro
et al., 1998; Kavanagh et al., 2014). The use of antimotility drugs delay the intestinal
clearance of organism and thereby increases the toxin absorption (Nataro et al., 1998).
Treatment of renal disease may include dialysis, hemofiltration, transfusion of packed
erythrocytes and platelet infusion (Nataro et al., 1998).
EIEC infections are usually self-limiting and do not require antibiotic treatment. Zinc
supplementation is found to be useful (Nataro et al., 1998).
2.11. Antibiotic resistance
The prevalence of antibiotic resistance in EPEC strains is increasing across the world. It is an
alarming problem in both developed and developing countries. EPEC strains display
resistance to a wide range of antibiotics such as penicillins, cephalosporins and
aminoglycosides (Subramanian et al., 1990). A study from Brazil reported a higher
prevalence of resistance among tEPEC rather than aEPEC. Conjugative multidrug-resistant
plasmid harboured by 30% of the typical isolates while 4% aEPEC carried the plasmid
(Scaletsky et al., 2010).
Antibiotic resistance in ETEC was detected from Calcutta for the first time in 1968. A marked
increase in the resistance began to be reported since 1980 when an outbreak occurred by the
strain O25: NM in the cruise ship. Multidrug resistance is found to be increasing among the
ETEC isolates due to the widespread use of antibiotics in countries where diarrhoea is
endemic like India and Banglades (Qadri et al., 2005).
A high-level multidrug resistance was reported among EAEC isolates across the world.
Extended Spectrum Beta-lactamase production and fluoroquinolone resistance were also
reported in clinical isolates of EAEC.EAEC strains that harbour the ESBL genes (CTX –M)
are reported increasingly (Jensen et al., 2014).

R e v i e w o f l i t e r a t u r e
P a g e | 34
Even though antibiotics are not recommended for the treatment of STEC infections, they
exhibit resistance to various antimicrobial agents (Croxen at al., 2013). Most of the strains
carried resistance determinants on class I integron integrated to plasmid (Novella
et al., 2011).
Resistance to sulphonamide and tetracyclines is common among the strains (Croxen at al.,
2013).
Antibiotic resistance is less reported in EIEC due to its lower incidence rate and morbidity.
Since there is a high similarity between EIEC and Shigella strains, EIEC seems to follow the
increased antimicrobial resistance trend of Shigella strains (Croxen at al., 2013). About 48%
of the EIEC strains isolated from America, Africa and Asia between 1970 and 2000, showed
tetracycline resistance ( Hartman
et al., 2003). Resistance to the first-line antibiotic was
reported in an EIEC isolate from Japan ( Ahmed et al ., 2005). The resistant determinants are
most commonly encoded on the plasmid and /or chromosome (Croxen at al., 2013).
2.11.1 Mechanism of antibiotic resistance
The molecular mechanisms of antibiotic resistance in E. coli are enzymatic inactivation, the
decreased permeability of bacterial membranes, promotion of antibiotic efflux and altered
target sites (Mandell et al., 2010). E. coli strains can produce ?-lactamase enzymes that can
inactivate the ?-lactam class of antibiotics by splitting the amide bond of ?-lactam ring. The
genes encoding ?-lactamase ( bla ) located either on chromosomal genes or on transferable
elements such as plasmids and transposons. In some strains, resistant determinants can be
found on integrons which can disseminate the resistance to other bacterial species when it is
mobilized by a transferable element. The ?-lactamase enzymes commonly produced by E.
coli strains are SHV, TEN, Amp C, CTX-M and carbapenemases which confer resistance to
cephalosporins (Mandell et al., 2010).
E. coli strains acquire resistance against aminoglycoside by producing aminoglycoside
modifying enzymes such as aminoglycoside phosphotransferase (APH (3′) – I, III),
aminoglycoside acetyl transferase (AAC (3')-I, IV, V, AAC (6')), aminoglycoside nucleotidyl
transferase ANT (2″), and AAC (6)-lb cr. These enzymes modify the antibiotic during the
process of transport across the cytoplasmic membrane. N-acetylation, O-nucleotidation and
O-phosphorylation are the modifications conferred by these enzymes (Mandell et al., 2010).
Chloramphenicol resistance is mediated by chloramphenicol acetyltransferase enzyme which
inactivates the drug by O-acetylation. The gene encoding the enzyme (cat) is located either on

R e v i e w o f l i t e r a t u r e
P a g e | 35
plasmid or on the chromosome. The decreased permeability of bacterial membrane also
results in chloramphenicol resistance in E. Coli (Mandell et al., 2010).
E. coli strains are found to be producing Erythromycin esterase enzyme that hydrolyses
lactone ring of macrolid antibiotics and thereby results in resistance. This is a plasmid-
mediated enzyme which results in high-level resistance
(Mandell et al., 2010).
Tetracycline resistance is mediated by active efflux of the antibiotic across the cell membrane
which results in reduced uptake or decreased accumulation of the antibiotic . The strains of E.
coli that possess tetracycline resistant determinants such as tet A, tet B produce an inner
membrane protein which mediates uptake (Mandell et al., 2010).
Quinolone and fluoroquinolone resistance in E. coli is mediated by mutations that drug
targets, mutations that reduce drug accumulation and plasmids that protect cells from lethal
effect of quinolones and its derivatives ( Jacoby et al., 2005) . The targets of these drugs are
DNA gyrase and Topoisomerase IV which are essential for cell division. Spontaneous
mutations occur in the genes encoding these enzymes is the main cause for the quinolone
resistance among the strains of E. coli . DNA gyrase is encoded by gyr A and gyr B while
topoisomerase IV is encoded by par C and par E (Mandell et al., 2010). The region of gyr A
and parC where amino acid substitution occurs is termed as the Quinolone-Resistance
Determining Region (QRDR)
( Jacoby et al., 2005). Genes encoded on plasmids can also
mediate quinolone resistance in E. coli and is termed as Plasmid-Mediated Quinolone
Resistance (PMQR). The plasmid-mediated quinolone resistance gene is called as qnr . The
product of this gene binds with DNA gyrase to protect it from the lethal action of quinolone
( Jacoby et al., 2005) . Quinolone resistance is also mediated through decreased cell wall
permeability and efflux pump mechanisms ( Jacoby et al., 2002) .
Resistance to sulphonamides and trimethoprim is mediated by alteration of target enzymes.
Sulphonamide resistance is mediated through the altered production of Dihydropteroate
synthase (DHPS) by sul I and sul II genes. This enzyme has the role in folic acid synthesis in
susceptible bacteria. The binding of sulfa drugs to this target inhibited when it is altered
which leads to the resistance. The mechanism of action of trimethoprim is inhibiting the
action of Dihydrofolate reductase enzyme (DHFR). In trimethoprim resistant bacteria, the
dfrA gene encodes an altered Dihydrofolate reductase enzyme (DHFR) which cannot bind
with the drug and hence the resistance (Mandell et al., 2010).

R e v i e w o f l i t e r a t u r e
P a g e | 36
2.12. Prevention and control
Sanitary measures to prevent faecal –oral transmission such as hand washing, chlorination of
water , hygienic preparation of food and sewage treatment are the measures to prevent and
control the infections with DEC (Baron et al.,1996).
2.13 Vaccines
Currently, there are no vaccines available for diarrheagenic E. coli infections (CDC, 2018).
Researchers are investigating vaccines to prevent infections with this enteric pathogen. It is a
major challenge to develop a vaccine against DEC because of the large number of serotypes
involved and the requirement to induce effective immunity in the gut (Gohar et al., 2016).
Conserved virulence factors of EPEC such as EspB, Intimin and BfpA have been explored for
the development of the vaccine. Vaccine studies for STEC infections are focusing on fusions
of stx 1 and stx 2 with different delivery mechanisms. Vaccines for ETEC infections include
toxin based vaccine; live attenuated, inactivated whole cell, hybrid and fimbrial antigen
vaccines. Dukoral is an inactivated whole cell oral vaccine with recombinant Cholera toxin B
subunit which provides short-term protection in travellers (Croxen et al., 2013).

M a t e r i a l s a n d M e t h o d s
P a g e | 37
3.1 Ethical considerations
The present study was approved by Institutional Ethic Committee of the Regional Medical
Research Centre, (Indian Council Medical Research), Dollygunj, Port Blair, Andaman
&Nicobar Islands of India. A written informed consent was obtained from the patient’s
parent/guardian prior to the collection of sample.
3.2 Study area
Andaman & Nicobar Islands
The Andaman & Nicobar Islands – a union territory of India – is situated in Bay of Bengal,
1200km away from Indian peninsula. It is located between 06 0
45″ and 13 0
41″ North latitude
and 92 0
12″ and 93 0
57” east longitude. Of the total 570 islands, only 38 islands are inhabited.
The Andaman Islands and the Nicobar Islands are two groups of this archipelago of Islands
which are separated by the 1 N parallel. The Andaman group of Islands constitutes South00
Andaman, Middle Andaman and Little Andaman while the Nicobar group of Islands includes
Great Nicobar, Nancowry, Car Nicobar, Chowra and Katchal ( www.mapsofindia.com ).
3.3 Study site and study period
Paediatric patients attended /admitted in various hospitals and PHCs (Govind Ballabh Pant
hospital (Tertiary hospital, only one referral hospital), INHS Dhanvantri and Chirayu Child
care hospital) during August 2013 to January 2016 were included in the study.
3.4 Patients and specimens
Inclusion criteria for patients
Patients attended (out-patients) /admitted (in-patients) in the hospitals with the following
criteria were included in the study.
1) Children of age between (0-5 years)
2) Acute diarrhoea defined as the passage of unformed stool, 3 or more times in 24 hours.
3) Parents willing to give informed consent.

M a t e r i a l s a n d M e t h o d s
P a g e | 38
Stool samples were obtained from the patients and transported in cold chain to the diarrhoeal
disease laboratory of Regional Medical Research Centre, (ICMR), Port Blair.
3.5 Processing of the stool sample
Stool specimens were collected from the patient with acute diarrhoea, prior to the
administration of antimicrobial agents and processed for the isolation of Diarrheagenic E.
coli . Clinical and demographic data were collected in a structured proforma. The specimens
were collected in sterile container (Hi-Media, Mumbai) and transported to the laboratory of
Regional Medical Research Centre (ICMR), Port Blair in cold chain. Then the samples were
processed within two hours by the using standard protocol. (Panchalingam et al ., 2012)
3.6 Isolation and biochemical identification of DEC
For the isolation of DEC, stool specimens were plated on MacConkey Agar (Hi-Media,
Mumbai, India) followed by 16-18 hours incubation at 37?C. Three to five typical lactose
fermenting colonies with different colony morphology per sample were selected and
subcultured in Mueller Hinton Agar (Difco, USA). Cultures from this nonselective medium
were tested for Indole test, Mannitol Motility test and Triple Sugar Iron test (Mackey and
Macartney)
Table 1. Characteristics of DEC in selected biochemical tests
Test Reaction
Indole Test
Mannitol Motility Test
Triple Sugar Iron Agar Positive
Mannitol fermenting, Motile
Acid/Acid, with gas, no H
2 S

M a t e r i a l s a n d M e t h o d s
P a g e | 39
3.7 Screening of DEC by PCR detection of virulence factors
DNA templates were prepared from the colonies with typical E. coli biochemical reactions by
rapid boiling method and subjected to multiplex PCR for the detection of different pathotypes
of DEC. In this study, we investigated the prevalence of EAEC, EPEC and ETEC pathotypes.
The role of other pathotypes eg NLF E. coli in diarrhoeal diseases among the children of
Andaman Islands was not included in the scope of the present study and might be a
limitation.
3.7.1 DNA extraction by rapid boiling method
A small portion of the bacterial growth with typical E. coli reactions from the colonies was
emulsified in 500µ l of Tris-EDTA (TE) buffer in 1.5ml micro centrifuge tube and boiled for
10 minutes followed by snap chilling in ice for 5 minutes. The heat treated bacterial
suspensions were centrifuged for 10,000 rpm for 10 minutes and the supernatants were used
as DNA template for PCR (Dutta S et al.,2013).
3.7.2 PCR detection of virulence factors
Multiplex PCR was performed with the DNA templates obtained and with specific primers,
as described previously (Table 2), for the detection of virulence genes such as eae,bfp
A ( EPEC), elt and est (ETEC), CVD432 (the nucleotide sequence of Eco- R1 Pst 1DNA
fragment pCVD432 of EAEC) and aaiC (encodes a secreted protein of the EAEC
pathogenicity island AAI). PCR was performed in a 25 µl reaction mixture containing 2.5 µl
of 10X PCR buffer, 0.5 µl of 2.5 mM deoxyribonucleoside triphosphates, 0.5 µl of 3U Taq
polymerase (Genei, India), 0.5 µl of 10 pM of each primers (Sigma, India), 1 µl of DNA
template (lysate) and 19.5µl sterile nuclease free deionized water. The cycling condition was
96°C for 4 minutes, 35 cycles of 95°C for 20 seconds, 57.5°C for 20 seconds, 72°C for 1
minute, with a final extension at 72°C for 7 minutes following Panchalingam et al ,2012 with
slight modifications. Positive and negative controls were used with each PCR set up. Strains
known to possess the target genes were used as the positive control and sterile distilled water
was used as the negative control. Control strains were kindly provided by National Institute
of Cholera and Enteric diseases (NICED), Calcutta. PCR products (10 µl) were confirmed by

M a t e r i a l s a n d M e t h o d s
P a g e | 40
electrophoresis using 1% (wt/vol) agarose gel containing ethidium bromide (Sigma, USA).
DNA bands were visualized and photographed under UV light in a gel documentation system
(Panchalingam et al., 2012).
Table 2. List of primers used for the screening of DEC isolates
Primer Target
gene Primer sequence(5′-3′) Amplico
n (bp) Reference
LT-F
LT-R elt CACACGGAGCTCCTCAGTC
CCCCCAGCCTAGCTTAGTTT 508 Panchalingam et al.,
2012
ST-F
ST-R est GCTAAACCAGTAGGGTCTTCAAAA
CCCGGTACAGGCAGGATTACAACA 147 Panchalingam et al.,
2012
BFPA-F
BFPA-R bfpA GGAAGTCAAATTCATGGGGG
GGAATCAGACGCAGACTGGT 367 Panchalingam et al.,
2012
CVD432-F
CVD432-R AatA CTGGCGAAAGACTGTATCAT
CAATGTATAGAAATCCGCTGTT 630 Panchalingam et al.,
2012
EAE-F
EAE-R eae CCCGAATTCGGCACAAGCATAAGC
CCCGGATCCGTCTCGCCAGTATTCG 881 Panchalingam et al.,
2012
AAIC-F
AAIC-R aaic ATTGGTCCTCAGGCATTTCAC
ACGACACCCCTGATAAACAA 215 Panchalingam et al.,
2012
3.8 Antibiograms of DEC isolates
The antibiograms of all DEC isolates were carried out by following the standard protocol .
Antimicrobial susceptibility of the isolates
Antimicrobial susceptibility tests of the isolates were carried out by following the CLSI
guidelines on Mueller-Hinton agar plates by the disc diffusion method (Bauer et al .,1966)
using commercially available discs (Table 3). Escheichia coli ATCC 25922 and
Staphylococcus aureus ATCC25923 strains were used as the quality control strains. On each
occasion, the zone sizes were examined by at least two individuals (Annexyre III).

M a t e r i a l s a n d M e t h o d s
P a g e | 41
Table 3. List of antimicrobial agents used for Antimicrobial susceptibility Testing(ABST) of
DEC icolates
Antibiotic Class Abbreviation Concentration(µg)
Amikacin Aminoglycosides AMK/AK 30
Ampicillin Penicillin AMP 10
Amoxicillin-clavulanic acid Cephalosporins AMC 30/10
Carbenicillin Penicillins CB 100
Cephalothin(Cephalexin) Cephalosporins(1st Gen) CEF 30
Cefuroxime Cephalosprins(2nd Gen) CXM 5
Cefixime Cephalosporins(3rd Gen) CFM 30
Ceftriaxone Cephalosporins(3rd Gen) CRO 30
Cefotaxime Cephalosporins(3rd Gen) CTX 30
Ceftazidime Cephalosporins(3rd Gen) CAZ 30
Gentamicin Aminoglycosides G/GEN 10
Imipenem Carbapenem IMP 10
Cotrimoxazole Sulfonamides COT 25
Tetracycline Tetracyckine TET 30
Chloramphenicol Phenicol CHL 30
Nitrofurantion Others NIT 300
Nalidixic acid Quinolone(1st Gen) NAL 30
Ciprofloaxacin Quinolone(3rd Gen) CIP 5
Norfloxacin Quinolone(3rd Gen) NOR 10
Ofloxacin Quinolone(3rd Gen) OFX 5
Gatifloxacin Quinolone(4th Gen) GAT 5
3.9 Detection of Extended spectrum ?-lactamase (ESBL) production
Phenotypic expression of potential Extended spectrum ?-lactamase enzyme was tested by
combination disc method recommended by Clinical and Laboratory Standards Institute
(CLSI). All the isolates, resistant to third generation cephalosporin were tested with both
cefotaxime and ceftazidime, alone and in combination with clavulanic acid. For disk
diffusion testing, a ?5 mm increase in a zone diameter for either antimicrobial agent (third
generation cephalosporins) tested in combination with clavulanic acid versus its zone when
tested alone confirmed an ESBL-producing organism.
3.10 Determination of Minimum Inhibitory Concentration (MIC)
The MICs of quinolone (nalidixic acid), fluoroquinolone (ciprofloxacin and norfloxacin),
third generation cephalosporins (ceftriaxone, ceftazidime and cefotaxime) and amoxicillin –
clavulanate for the resistant strains was determined by E-test (AB Bio disk, Solna,Swden)

M a t e r i a l s a n d M e t h o d s
P a g e | 42
and the readings were interpreted using the CLSI breakpoint criteria (CLSI, 2012) (Annexure
IV)
3.11 Preservation of DEC isolates
All the isolates of DEC are preserved in the Diarrhoeal Disease Laboratory, RMRC, Port
Blair. The strains were preserved in nutrient agar stab and 20% glycerol stock. The inoculated
nutrient stabs were stored in the room temperature while the glycerol stocks were stored in
-70 0
C(Annexure I 1.14 and Annexure II 2.10)
3.12 Isolation of nucleic acid
The genomic DNA and plasmid DNA of all DEC isolates were obtained by the extraction
procedure followed by standard protocols.
3.12.1 Isolation of genomic DNA
Genomic DNA was isolated from overnight grown cultures in Luria Broth following Cetyl
Trimethyl Ammonium Bromide (CTAB) method (Ausubel et al.,1999).
The procedure for isolation of Chromosomal DNA is as follows (Annexure I and Annexure
II)
? 5ml of inoculated Luria –Bertani Broth, after overnight incubation at 37 0
C was taken
in a micro centrifuge and centrifuged at 15,000 rpm for 10 min at 4 0
C.
? The pellets were washed in 1ml Normal Saline and again centrifuged at 15,000 rpm
for 10 min at 4 0
C.
? Bacterial pellets, so obtained were re-suspended in 400µl Tris-EDTA buffer (50mM
Trisma, 10mM EDTA; pH-8.0) and 40µl of lysozyme (10mg/ml).
? Pellets were vortexed to make a suspension.
? Incubated at 37 0
C for 2 hours.
? 56µl of 10% SDS and 10µl of freshly prepared Proteinase K(10 mg/ml) were added to
it.
? Tubes were incubated at 65 0
C for 30 min.
? 80µl 5M NaCl and 64µl of CTAB /NaCl were added to each tube and mixed
thoroughly by vortexing.
? The tubes were then incubated at 65 0
C for 30 min.
? Equal amount of Chloroform: Isoamyl alcohol (24:1) was added to each tube.
? Centrifuged at 15,000 rpm for 15 min.
? The upper aqueous phase was withdrawn into a fresh micro centrifuge tube.

M a t e r i a l s a n d M e t h o d s
P a g e | 43
? Double volume of chilled absolute ethanol was added to it to precipitate DNA.
? Tubes were incubated at -70 0
C overnight.
? After the incubation the tubes were centrifuged at 15,000 rpm for 15mins.
? The supernatants were discarded and the pellets were air-dried and dissolved inTris –
EDTA Buffer (pH-8.0) and stored at -20°C for subsequent use.
3.12.2 Isolation of plasmid DNA
The procedure of plasmid DNA isolation from the isolates as described by Kado and
Liu,1981 or Qiagen Miniprep Plasmid Isolation Kit.
? 5ml overnight grown bacterial culture in LB Broth medium was taken in a micro
centrifuge tube and centrifuged at 10,000 rpm for 5 min.
? The pellets were washed once with 1ml TAE buffer (pH-8.0) and centrifuged 10,000
rpm for 5 min.
? Bacterial pellets, so obtained, were re-suspended in 100 ?l lysing solution (pH-
12.6) to lyse the cell.
? The lysates were subsequently incubated at 55 0
C -60 0
C in a water bath for 5minutes.
? Equal volume of phenol: chloroform mixture (1:!v/v) was added to the cell lysate,
mixed well and centrifuged at 15,000 rpm for 15 minutes at room temperature.
? The upper aqueous phase was carefully taken out in fresh microfuge tubes.
? 30µl of the extracted phase mixture with 3 µl of loading buffer was electrophoresed in
0.8% agarose gels.
3.13 Detection of antimicrobial resistance genes
PCR was carried out to detect genes encoding resistance to ?-lactam ( bla
TEM , bla
OXA-
1 , bla
OXA-7 , bla
SHV and bla
CTX-M3 ), aminoglycosides ( aadB , aac3 , aaaC2 , aphA1 and
aphA2 ),chloramphenicol ( cat1 ),tetracycline( tet A, tet B, tet C, tet D, tet E and tet
Y),trimethoprim ( dhfrI and dhfr V) and sulphonamides( sul I and Sul II). The resistance
genes to be detected were chosen based on their relative importance, as observed in
resistant E. coli isolates (Maynard et al., 2003; Pazhani et al., 2008). Therefore, 21
genes coding for resistance to six antimicrobials (?-lactams, aminoglycosides
,chloramphenicol, tetracycline, trimethoprim, sulphonamides) were chosen.

M a t e r i a l s a n d M e t h o d s
P a g e | 44
DNA obtained by CTAB extraction procedure was used as the template for PCR
assays. All the assays were carried out as single plex PCR assays. Amplifications were
performed with 5.0µl of template DNA. The PCR master mix (50µl) consist of 36µl
of sterile deionized water, 5.0µl of 10X PCR buffer (Bangalore Genei, India),1.0µl of
2mM deoxyribonucleoside triphosphates, 1U of Taq DNA polymerase (Bangalore
Genei, India) and 25pmol of each primer. Amplification was carried out in a PCR
thermal cycler (Applied Biosystem-Veriti) by using the following conditions; 5 min at
94 0
C followed by 30 cycles of 94 0
C for 30sec, 50 0C
C and 72 0
C for 1.5 min.
A sample of 5µl of the PCR product was electrophoresed for verification of size and
purity in 1% (wt/vol) agarose in 1X TAE (Tris-acetate-EDTA) buffer and documented
in gel documentation system (Vilber Lourmat Gel-doc, Model: Bioprint xpres
Table 4. Details of primers used for the screening of antimicrobial resistant
determinants

M a t e r i a l s a n d M e t h o d s P a g e | 45
Class of Antibiotics Target Gene Sequences(5′-3′) Amplicon size
(bp) Reference
?-lactams blaTEM GAGTATTCAACATTTTCGT
857 Maynard et al., 2003/Pazhani et al., 2008ACCAATGCTTAATCAGTGA

blaSHV TCGCCTGTGTATTATCTCCC
768 Maynard et al., 2003/Pazhani et al., 2008 CGCAGATAAATCACCACAATG

blaOXA-1 GCAGCGCCAGTGCATCAAC
198 Maynard et al., 2003/Pazhani et al., 2008 CCGCATCAAATGCCATAAGTG
AGTTCTCTGCCGAAGCC

blaOXA-7 TCTCAACCCAACCAACCC
591 Maynard et al., 2003/Pazhani et al., 2008 AATCACTGCGTCAGTTCAC

blaCTX-M3 TTTATCCCCCACAACCCAG
701 Maynard et al., 2003/Pazhani et al., 2008 TTTATCCCCCACAACCCAG
Aminoglycosides aadB TCCAGAACCTTGACCGAAC
700 Maynard et al., 2003/Pazhani et al., 2008GCAAGACCTCAACCTTTTCC

aaaC2 CGGAAGGCAATAACGGAG
740 Maynard et al., 2003/Pazhani et al., 2008 TCGAACAGGTAGCACTGAG

aac3 GTGTGCTGCTGGTCCACAGC
627 Maynard et al., 2003/Pazhani et al., 2008 AGTTGACCCAGGGCTGTCGC

aphA1 ATGGGCTCGCGATAATGTC
600 Maynard et al., 2003/Pazhani et al., 2008 CTCACCGAGGCAGTTCCAT

aphA2 GAACAAGATGGATTGCACGC
680 Maynard et al., 2003/Pazhani et al., 2008 GCTCTTCAGCAATATCACGG

M a t e r i a l s a n d M e t h o d s P a g e | 46
Class of Antibiotics Target Gene Sequencecs(5′-3′) Amplicon size(bp) Refernces
Tetracycline tet A GTGAAACCCAACATACCCC
888 Maynard et al., 2003/Pazhani et al., 2008GAAGGCAAGCAGGATGTAG

tet B CCTTATCATGCCAGTCTTGC
774 Maynard et al., 2003/Pazhani et al., 2008 ACTGCCGTTTTTTCGCC

tet C ACTTGGAGCCACTATCGAC
881 Maynard et al., 2003/Pazhani et al., 2008 CTACAATCCATGCCAACCC

tet D TGGGCAGATGGTCAGATAAG
827 Maynard et al., 2003/Pazhani et al., 2008 CAGCACACCCTGTAGTTTTC

tet E TTAATGGCAACAGCCAGC
853 Maynard et al., 2003/Pazhani et al., 2008 TCCATACCCATCCATTCCAC

tet Y ACCGCACTCATTGTTGTC
823 Maynard et al., 2003/Pazhani et al., 2008 TTCCAAGCAGCAACACAC
Phenicol Cat 1 AGTTGCTCAATGTACCTATAACC
547 Maynard et al., 2003/Pazhani et al., 2008TTGTAATTCATTAAGCATTCTGCC
Trimethoprim dhfrI AAGAATGGAGTTATCGGGAATG
391 Maynard et al., 2003/Pazhani et al., 2008GGGTAAAAACTGGCCTAAAATTG

dhfrV CTGCAAAAGCGAAAAACGG
432 Maynard et al., 2003/Pazhani et al., 2008 AGCAATAGTTAATGTTTGAGCTAAAG
Sulphonamides sul 1 TTCGGCATTCTGAATCTCAC
822 Maynard et al., 2003/Pazhani et al., 2008ATGATCTAACCCTCGGTCTC

sul II CGGCATCGTCAACATAACC
722 Maynard et al., 2003/Pazhani et al., 2008 GTGTGCGGATGAAGTCAG

M a t e r i a l s a n d M e t h o d s
P a g e | 47
3.14 Characterization of quinolone and fluoroquinolone resistant DEC isolates
Selected isolates of multidrug resistant DEC were screened for the mutations in the
Quinolone Resistance Determining Region (QRDR) and Plasmid Mediated Quinolone
Resistant determinants.
3.14.1 Amplification of the quinolone resistance determining regions(QRDRs)
Quinolone Resistance Determining Region includes gyr A, gyr B, and par C were amplified as
reported Dutta et al ( Dutta et al., 2005) with the four sets of primers (Table 5). For each
strain, 10ng of the chromosomal DNA was used in the PCR assay. Amplifications were
performed with 1µl of isolated chromosomal DNA. The PCR mixture (50µl) included 40µl of
sterile deionized water, 5.0 µl of 10X PCR buffer (Banglore Genei, India),1.0 µl 3mM
deoxynucleoside triphosphates,1U of Taq DNA polymerase (Banglore Genei. India) and
25pmol of each primer. The PCR conditions for amplification of the QRDR regions includes
initial denaturation at 92 0
C for 5 min, followed by 30 cycles of 92 0
C for 60 sec, 64 0
C for 60
sec,74 0
C for 2 min and final extension at 74 0
C for 10 min.
A sample of 10 µl of the PCR product was electrophoresed for verification of size and purity
in 1% (wt/vol) agarose in 1X TAE (Tris-acetate-EDTA) buffer and documented in gel
documentation system (Vilber Lourmat Gel-doc, Model: Bioprint xpress).
Table 5. Details of primers used for the amplification of QRDR
Gene Sequences(5'-3') Amplicon size
(bp) Reference
gyrA TACACCGGTCAACATTGAGG
648 Dutta et al., 2005TTAATGATTGCCGCCGTCGG
gyrB TGAAATGACCCGCCGTAAAGG
309 Dutta et al., 2005GCTGTGATAACGCAGTTTGTCCGGG
parC GTCTGAACTGGGCCTGAATGC
249 Dutta et al., 2005AGCAGCTCGGAATATTTCGACAA
3.14.2 Screening of PMQR determinants

M a t e r i a l s a n d M e t h o d s
P a g e | 48
PCR was performed to screen the presence of six major groups of PMQR determinants,
qnrA,qnrB, qnrC, qnrS, aac (6′)-lb-cr and qepA (Kim et al., 2009). The PCR mixture (50µl)
included 5.0µl of 10X PCR buffer (Bangalore Genei, India), 1.0µl of 2mM deoxynucleoside
triphosphate,1U of Taq DNA polymerase (Bangalore,Genei,India) and 25 pmol of each
primer.
Screening of the six PMQR determinants (Table. 6) was done with two sets of multiplex
PCR, one for qnrA, qnrB, qnrC and qnrS (PCR conditions: 94 0
C for 60sec, 64 0
C for 60sec
and 72 0
C for 60sec with a cycle number of 35) and other for aac (6′)-lbcr and qep A (94 0
C for
45sec, 55 0
C for 45sec and 72 0
C for 45sec with a cycle number of 34).
A sample of 10 µl of the PCR product was electrophoresed for verification of size and purity
in 1% (wt/vol) agarose in 1X TAE (Tris-acetate-EDTA) buffer and documented in gel
documentation system (Vilber Lourmat Gel-doc, Model: Bioprint xpress).
Table 6. Details of primers used for the screening of PMQR determinants
Gene Sequence(5'-3') Amplicon size
(bp) Reference
qnrA ATTTCTCACGCCAGGATTTG
516 Kim et al.,2009GATCGGCAAAGGTTAGGTCA
qnrB GATCGTGAAAGCCAGAAAGG
476 Kim et al.,2009ATGAGCAACGATGCCTGGTA
qnrC GGGTTGTACATTTATTGAATCG
307 Kim et al.,2009CACCTACCCATTTATTTTCA
qnrS GCAAGTTCATTGAACAGGGT
428 Kim et al.,2009TCTAAACCGTCGAGTTCGGCG
qepA AACTGCTTGAGCCCGTAGAT
596 Kim et al.,2009GTCTACGCCATGGACCTCAC
aac(6')-lb-cr TTGCGATGCTCTATGAGTGGCTA
482 Kim et al.,2009CTCGAATGCCTGGCGTGTTT
3.15 Random Amplified Polymorphic DNA (RAPD) PCR

M a t e r i a l s a n d M e t h o d s
P a g e | 49
RAPD PCR was performed for all multidrug resistant (MDR) isolates in thermal cycle Veriti
using the arbitrary primers PB1 and M16. Purified genomic DNA isolated by CTAB method
was used for the PCR amplification. The primers were selected on the basis of reproducibility
and discriminatory power in preliminary experiments from a pool for several
oligonucleotides. RAPD PCR was carried out for all MDR DEC isolates using the primers
PB1 (5′-GCG CTG GCT CAG-3′) and M16 (5′ AAA GAA GGA CTC AGC GAC TGC G
3′) for 45 cycles, following the conditions 1 min at 94 0
C, 1 min at 34 0
C, 1.5 min at 72 0
C and
one final extension cycle (1 min at 94 0
C, 1 min at 34 0
C,10 min at 72 0
C). (Olivier et al., 1999).
Amplified product (10µl) was electrophoresed in 1% (wt/vol) agarose in 1X TAE (Tris-
acetate-EDTA) buffer and documented in gel documentation system (Vilber Lourmat Gel-
doc, Model: Bioprint xpress).
The RAPD pattern of isolates with both primers was compared and the isolates were grouped
based on the pattern. Representative strains were selected from each group for sequencing to
detect the mutation in QRDR and PMQR detection.
3.16 Nucleotide sequence and analysis
Sequencing of the PCR positive samples was carried out for the confirmation and detection of
various mutations.
3.16.1 Nucleotide sequencing of the PCR products
ABI PRISM Big Dye Terminator cycle sequencing ready reaction kit, V3.1 was used for the
sequencing of the PCR products. In dye–terminator sequencing, each of the four
dideoxynucleotide chain terminators was labelled with fluorescent dyes of different
wavelengths of fluorescence and emission. The terminator Ready reaction mix (TRRM)
contains Adenine-Dye terminator labelled with dichloro (R6G),Guanine-Dye terminator
labelled with dichloro (R110), Cytosine-Dye Terminator labelled with dichloro (ROX),
Thiamine-Dye terminator labelled with dichloro (TAMARA), deoxynucleotide triphosphates
(dATP, dCTP, dITP, dUTP), AmpliTaq DNApolymerase, MgCl
2 and HCl buffer (Applied
Biosystems, USA).
Preparation of cycle sequencing reaction mix:
Two cycle sequencing reactions (one with forward and the other with reverse primer) were
carried out of each PCR product. The reaction mix (10µl) containing 2?l of TRRM, 0.5?l of
forward/reverse primer (0.5?M concentration), 1?l of template (depending on the
concentration of the PCR products) and 6.5?l of nuclease free distilled water. The following

M a t e r i a l s a n d M e t h o d s
P a g e | 50
conditions were used to carry out the PCR, 96 0
C for10sec, 50 0
C for 5sec and 60 0
C for 4 min,
with a cycle number of 25.
Post cycle sequencing purification of PCR products:
In post cycle sequencing reaction, ethanol/EDTA/sodium acetate method was used to purify
the PCR products. Mix was prepared by using 1-2 ?l of 0.5M EDTA,10 ?l of nuclease free
water, 2-3 ?l of 3M sodium acetate and 50 ?l of absolute ethanol to 10 ?l of cycle sequenced
products. The mixture was incubated for 15 minutes and centrifuged at 10,000 rpm for 30
minutes at room temperature. The supernatant was discarded and the tubes were centrifuged
again at 10,000 rpm for5 minutes at room temperature. Ethanol was removed completely by
air drying the pellet at room temperature for 30 minutes. The pellet was reconstituted in 10 ?l
of Hi-DiTM formamide (Applied Biosystem, USA). The denaturation of DNA was carried
out 95 0
C for 2 minutes followed by snap chilling on ice for a minute. The contents were
mixed manually, spin down and loaded in automated sequencer, ABI 3010 genetic analyser
(Applied Biosystem, USA ).
Nucleotide sequence:
The nucleotide sequences were collected using an automated sequencer, ABI 3010 Genetic
analyser (Applied system, USA). The cycle sequenced products were subjected to capillary
electrophoresis. The fluorescence produced during the reaction was detected by an optical
detection device. These signals were converted to digital data by the data collection software
and recorded the data.
3.16.2 Analysis of Sequence data
The forward and reverse sequences collected from sequencer were checked and manually
edited MEGA VI (Tamura et al., 2011). The checked and corrected nucleotide sequences of
DEC isolates were adjusted in FASTA format. Contig sequences were them compared with
the other reference sequences in BLAST of the NCBI database for detection of any mutation.